hl2 system Search Results


m3 38 hybridoma  (ATCC)
93
ATCC m3 38 hybridoma
M3 38 Hybridoma, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m3 38 hybridoma/product/ATCC
Average 93 stars, based on 1 article reviews
m3 38 hybridoma - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier
pfuse2 clig hl2  (InvivoGen)
94
InvivoGen pfuse2 clig hl2

Pfuse2 Clig Hl2, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pfuse2 clig hl2/product/InvivoGen
Average 94 stars, based on 1 article reviews
pfuse2 clig hl2 - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier
agaacgaccaccatcaactc asgr2  (Proteintech)
90
Proteintech agaacgaccaccatcaactc asgr2

Agaacgaccaccatcaactc Asgr2, supplied by Proteintech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/agaacgaccaccatcaactc asgr2/product/Proteintech
Average 90 stars, based on 1 article reviews
agaacgaccaccatcaactc asgr2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
anti cd45  (ATCC)
90
ATCC anti cd45
Representative expression of residual anti-CD45RB (anti-rat); CD45RB; and <t>pan-CD45</t> by immunofluorescence. (A) Lymph node cells isolated on day 6 and 11 from animals treated with three doses of anti-CD45RB (MB23G2) vs. untreated animals. The number in each histogram is the percent of positive cells (mean ± SEM) in 3–5 experiments per marker. (* P < 0.5 vs. control). (B) Spleen cells isolated on day 6 from untreated controls vs. animals treated with three doses of either anti-CD45RB mAb MB23G2 or MB4B4. Mean channel number (MCN) is indicated in each histogram. Data are representative of three experiments. Negative controls are indicated as dotted histograms.
Anti Cd45, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti cd45/product/ATCC
Average 90 stars, based on 1 article reviews
anti cd45 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
antibody anti dnah6  (Proteintech)
93
Proteintech antibody anti dnah6
Figure 5. Immunofluorescence staining and western blotting analysis of IDA-associated proteins in spermatozoa obtained from normal control and patients with DNAH3 variants. (A – C) Immunofluorescence staining of DNAH1 (A), <t>DNAH6</t> (B) and DNALI1 (C) in spermatozoa from patients and normal controls. Red, DNAH1 in (A), DNAH6 in (B), DNALI1 in (C); green, α-Tubulin; blue, DAPI; scale bars, 5 μm. (D – F) Western blotting analysis of DNAH1(D), DNAH6 (E), DNALI1 (F) in sperm lysates from the patients and normal control.
Antibody Anti Dnah6, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibody anti dnah6/product/Proteintech
Average 93 stars, based on 1 article reviews
antibody anti dnah6 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier
electrode holder  (Molecular Devices LLC)
91
Molecular Devices LLC electrode holder
Figure 5. Immunofluorescence staining and western blotting analysis of IDA-associated proteins in spermatozoa obtained from normal control and patients with DNAH3 variants. (A – C) Immunofluorescence staining of DNAH1 (A), <t>DNAH6</t> (B) and DNALI1 (C) in spermatozoa from patients and normal controls. Red, DNAH1 in (A), DNAH6 in (B), DNALI1 in (C); green, α-Tubulin; blue, DAPI; scale bars, 5 μm. (D – F) Western blotting analysis of DNAH1(D), DNAH6 (E), DNALI1 (F) in sperm lysates from the patients and normal control.
Electrode Holder, supplied by Molecular Devices LLC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/electrode holder/product/Molecular Devices LLC
Average 91 stars, based on 1 article reviews
electrode holder - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier
hl-2 peristaltic pump  (Shanghai QingPu HuXi)
90
Shanghai QingPu HuXi hl-2 peristaltic pump
Figure 5. Immunofluorescence staining and western blotting analysis of IDA-associated proteins in spermatozoa obtained from normal control and patients with DNAH3 variants. (A – C) Immunofluorescence staining of DNAH1 (A), <t>DNAH6</t> (B) and DNALI1 (C) in spermatozoa from patients and normal controls. Red, DNAH1 in (A), DNAH6 in (B), DNALI1 in (C); green, α-Tubulin; blue, DAPI; scale bars, 5 μm. (D – F) Western blotting analysis of DNAH1(D), DNAH6 (E), DNALI1 (F) in sperm lysates from the patients and normal control.
Hl 2 Peristaltic Pump, supplied by Shanghai QingPu HuXi, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hl-2 peristaltic pump/product/Shanghai QingPu HuXi
Average 90 stars, based on 1 article reviews
hl-2 peristaltic pump - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
hl2–mocap  (MOCAP Inc)
90
MOCAP Inc hl2–mocap
Figure 5. Immunofluorescence staining and western blotting analysis of IDA-associated proteins in spermatozoa obtained from normal control and patients with DNAH3 variants. (A – C) Immunofluorescence staining of DNAH1 (A), <t>DNAH6</t> (B) and DNALI1 (C) in spermatozoa from patients and normal controls. Red, DNAH1 in (A), DNAH6 in (B), DNALI1 in (C); green, α-Tubulin; blue, DAPI; scale bars, 5 μm. (D – F) Western blotting analysis of DNAH1(D), DNAH6 (E), DNALI1 (F) in sperm lysates from the patients and normal control.
Hl2–Mocap, supplied by MOCAP Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hl2–mocap/product/MOCAP Inc
Average 90 stars, based on 1 article reviews
hl2–mocap - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
ccdc 836,547 (hl2)  (Cambridge Crystallographic)
90
Cambridge Crystallographic ccdc 836,547 (hl2)
Figure 5. Immunofluorescence staining and western blotting analysis of IDA-associated proteins in spermatozoa obtained from normal control and patients with DNAH3 variants. (A – C) Immunofluorescence staining of DNAH1 (A), <t>DNAH6</t> (B) and DNALI1 (C) in spermatozoa from patients and normal controls. Red, DNAH1 in (A), DNAH6 in (B), DNALI1 in (C); green, α-Tubulin; blue, DAPI; scale bars, 5 μm. (D – F) Western blotting analysis of DNAH1(D), DNAH6 (E), DNALI1 (F) in sperm lysates from the patients and normal control.
Ccdc 836,547 (Hl2), supplied by Cambridge Crystallographic, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ccdc 836,547 (hl2)/product/Cambridge Crystallographic
Average 90 stars, based on 1 article reviews
ccdc 836,547 (hl2) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
peristaltic pump hl-2  (Shanghai QingPu HuXi)
90
Shanghai QingPu HuXi peristaltic pump hl-2
Figure 5. Immunofluorescence staining and western blotting analysis of IDA-associated proteins in spermatozoa obtained from normal control and patients with DNAH3 variants. (A – C) Immunofluorescence staining of DNAH1 (A), <t>DNAH6</t> (B) and DNALI1 (C) in spermatozoa from patients and normal controls. Red, DNAH1 in (A), DNAH6 in (B), DNALI1 in (C); green, α-Tubulin; blue, DAPI; scale bars, 5 μm. (D – F) Western blotting analysis of DNAH1(D), DNAH6 (E), DNALI1 (F) in sperm lysates from the patients and normal control.
Peristaltic Pump Hl 2, supplied by Shanghai QingPu HuXi, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/peristaltic pump hl-2/product/Shanghai QingPu HuXi
Average 90 stars, based on 1 article reviews
peristaltic pump hl-2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
hl-2 infusion pump  (Shanghai QingPu HuXi)
90
Shanghai QingPu HuXi hl-2 infusion pump
Figure 5. Immunofluorescence staining and western blotting analysis of IDA-associated proteins in spermatozoa obtained from normal control and patients with DNAH3 variants. (A – C) Immunofluorescence staining of DNAH1 (A), <t>DNAH6</t> (B) and DNALI1 (C) in spermatozoa from patients and normal controls. Red, DNAH1 in (A), DNAH6 in (B), DNALI1 in (C); green, α-Tubulin; blue, DAPI; scale bars, 5 μm. (D – F) Western blotting analysis of DNAH1(D), DNAH6 (E), DNALI1 (F) in sperm lysates from the patients and normal control.
Hl 2 Infusion Pump, supplied by Shanghai QingPu HuXi, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hl-2 infusion pump/product/Shanghai QingPu HuXi
Average 90 stars, based on 1 article reviews
hl-2 infusion pump - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
primers hl1 forward and hl2 reverse  (CinnaGen Co)
90
CinnaGen Co primers hl1 forward and hl2 reverse
Figure 5. Immunofluorescence staining and western blotting analysis of IDA-associated proteins in spermatozoa obtained from normal control and patients with DNAH3 variants. (A – C) Immunofluorescence staining of DNAH1 (A), <t>DNAH6</t> (B) and DNALI1 (C) in spermatozoa from patients and normal controls. Red, DNAH1 in (A), DNAH6 in (B), DNALI1 in (C); green, α-Tubulin; blue, DAPI; scale bars, 5 μm. (D – F) Western blotting analysis of DNAH1(D), DNAH6 (E), DNALI1 (F) in sperm lysates from the patients and normal control.
Primers Hl1 Forward And Hl2 Reverse, supplied by CinnaGen Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers hl1 forward and hl2 reverse/product/CinnaGen Co
Average 90 stars, based on 1 article reviews
primers hl1 forward and hl2 reverse - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


Journal: Immunity

Article Title: Human immunoglobulin repertoire analysis guides design of vaccine priming immunogens targeting HIV V2-apex broadly neutralizing antibody precursors

doi: 10.1016/j.immuni.2022.09.001

Figure Lengend Snippet:

Article Snippet: pFUSE2-CLIg-hL2 , InvivoGen , Cat# pfuse2-hcll2.

Techniques: Recombinant, Binding Assay, Transferring, Sequencing, Mass Spectrometry, Transfection, Electron Microscopy, Software, Amplification, Protein Binding

Representative expression of residual anti-CD45RB (anti-rat); CD45RB; and pan-CD45 by immunofluorescence. (A) Lymph node cells isolated on day 6 and 11 from animals treated with three doses of anti-CD45RB (MB23G2) vs. untreated animals. The number in each histogram is the percent of positive cells (mean ± SEM) in 3–5 experiments per marker. (* P < 0.5 vs. control). (B) Spleen cells isolated on day 6 from untreated controls vs. animals treated with three doses of either anti-CD45RB mAb MB23G2 or MB4B4. Mean channel number (MCN) is indicated in each histogram. Data are representative of three experiments. Negative controls are indicated as dotted histograms.

Journal:

Article Title: Antibody-mediated targeting of CD45 isoforms: A novel immunotherapeutic strategy

doi:

Figure Lengend Snippet: Representative expression of residual anti-CD45RB (anti-rat); CD45RB; and pan-CD45 by immunofluorescence. (A) Lymph node cells isolated on day 6 and 11 from animals treated with three doses of anti-CD45RB (MB23G2) vs. untreated animals. The number in each histogram is the percent of positive cells (mean ± SEM) in 3–5 experiments per marker. (* P < 0.5 vs. control). (B) Spleen cells isolated on day 6 from untreated controls vs. animals treated with three doses of either anti-CD45RB mAb MB23G2 or MB4B4. Mean channel number (MCN) is indicated in each histogram. Data are representative of three experiments. Negative controls are indicated as dotted histograms.

Article Snippet: Anti-CD45 (TIB 122, ATCC) was a gift from Kim Bottomly (Yale University, New Haven, CT).

Techniques: Expressing, Immunofluorescence, Isolation, Marker

Effective anti-CD45RB MB23G2 induces a shift towards expression of the low molecular weight CD45 isoforms in T cells. Anti-CD45 immunoblot on day 6 using cell lysates from animals that were untreated or treated wtih MB23G2 (effective) or MB4B4 (ineffective) anti-CD45RB mAb. (A) Splenic T cells (Left) and B cells (Right) from naive (untransplanted) animals. (B) Splenic T cells from islet allograft recipients. The numbered arrowheads indicate the number of alternative exons used to generate CD45 bands of each size, as defined (7, 25) and confirmed using lysates from transfectants expressing single CD45 isoforms (from K. Bottomly, Yale University).

Journal:

Article Title: Antibody-mediated targeting of CD45 isoforms: A novel immunotherapeutic strategy

doi:

Figure Lengend Snippet: Effective anti-CD45RB MB23G2 induces a shift towards expression of the low molecular weight CD45 isoforms in T cells. Anti-CD45 immunoblot on day 6 using cell lysates from animals that were untreated or treated wtih MB23G2 (effective) or MB4B4 (ineffective) anti-CD45RB mAb. (A) Splenic T cells (Left) and B cells (Right) from naive (untransplanted) animals. (B) Splenic T cells from islet allograft recipients. The numbered arrowheads indicate the number of alternative exons used to generate CD45 bands of each size, as defined (7, 25) and confirmed using lysates from transfectants expressing single CD45 isoforms (from K. Bottomly, Yale University).

Article Snippet: Anti-CD45 (TIB 122, ATCC) was a gift from Kim Bottomly (Yale University, New Haven, CT).

Techniques: Expressing, Molecular Weight, Western Blot

Figure 5. Immunofluorescence staining and western blotting analysis of IDA-associated proteins in spermatozoa obtained from normal control and patients with DNAH3 variants. (A – C) Immunofluorescence staining of DNAH1 (A), DNAH6 (B) and DNALI1 (C) in spermatozoa from patients and normal controls. Red, DNAH1 in (A), DNAH6 in (B), DNALI1 in (C); green, α-Tubulin; blue, DAPI; scale bars, 5 μm. (D – F) Western blotting analysis of DNAH1(D), DNAH6 (E), DNALI1 (F) in sperm lysates from the patients and normal control.

Journal: eLife

Article Title: DNAH3 deficiency causes flagellar inner dynein arm loss and male infertility in humans and mice

doi: 10.7554/elife.96755

Figure Lengend Snippet: Figure 5. Immunofluorescence staining and western blotting analysis of IDA-associated proteins in spermatozoa obtained from normal control and patients with DNAH3 variants. (A – C) Immunofluorescence staining of DNAH1 (A), DNAH6 (B) and DNALI1 (C) in spermatozoa from patients and normal controls. Red, DNAH1 in (A), DNAH6 in (B), DNALI1 in (C); green, α-Tubulin; blue, DAPI; scale bars, 5 μm. (D – F) Western blotting analysis of DNAH1(D), DNAH6 (E), DNALI1 (F) in sperm lysates from the patients and normal control.

Article Snippet: WB (1:200) Antibody Anti- DNAH6 (Rabbit polyclonal) Proteintech 18080–1- AP, RRID: AB_2878493 IF (1:50), WB (1:150) Antibody Anti- DNAH8 (Rabbit polyclonal) Atlas HPA028447, RRID: AB_10599600 IF (1:200) Antibody Anti- DNAH17 (Rabbit polyclonal) Proteintech 24488–1- AP, RRID: AB_2879568 IF (1:50) Antibody Anti- DNAI1 (Rabbit polyclonal) Proteintech 12756–1- AP, RRID: AB_10643244 IF (1:50) Antibody Anti- DNALI1 (Rabbit polyclonal) Proteintech 17601–1- AP, RRID: AB_2095372 IF (1:50), WB (1:150) Antibody Anti- TOM20 (Rabbit polyclonal) Proteintech 11802–1- AP, RRID: AB_2207530 IF (1:50) Antibody Anti- SLC25A4 (Rabbit polyclonal) Signalway 32484, RRID: AB_2941094 IF (1:100) Antibody Anti- alpha tubulin (Mouse monoclonal) Abcam ab7291, RRID: AB_2241126 IF (1:500) Wang, Shen, Yang et al. eLife 2024;13:RP96755.

Techniques: Immunofluorescence, Staining, Western Blot, Control

Figure 6. Immunofluorescence staining and western blotting analysis of IDA-associated proteins in spermatozoa from WT and Dnah3 KO mice. (A – C) Immunofluorescence staining of DNAH1 (A), DNAH6 (B) and DNALI1 (C) in spermatozoa from Dnah3 KO and WT mice. Red, DNAH1 in (A), DNAH6 in (B), DNALI1 in (C); green, α-Tubulin; blue, DAPI; scale bars, 5 μm. (D – F) Western blotting analysis of DNAH1(D), DNAH6 (E) and DNALI1 (F) in spermatozoa lysates from Dnah3 KO and WT mice.

Journal: eLife

Article Title: DNAH3 deficiency causes flagellar inner dynein arm loss and male infertility in humans and mice

doi: 10.7554/elife.96755

Figure Lengend Snippet: Figure 6. Immunofluorescence staining and western blotting analysis of IDA-associated proteins in spermatozoa from WT and Dnah3 KO mice. (A – C) Immunofluorescence staining of DNAH1 (A), DNAH6 (B) and DNALI1 (C) in spermatozoa from Dnah3 KO and WT mice. Red, DNAH1 in (A), DNAH6 in (B), DNALI1 in (C); green, α-Tubulin; blue, DAPI; scale bars, 5 μm. (D – F) Western blotting analysis of DNAH1(D), DNAH6 (E) and DNALI1 (F) in spermatozoa lysates from Dnah3 KO and WT mice.

Article Snippet: WB (1:200) Antibody Anti- DNAH6 (Rabbit polyclonal) Proteintech 18080–1- AP, RRID: AB_2878493 IF (1:50), WB (1:150) Antibody Anti- DNAH8 (Rabbit polyclonal) Atlas HPA028447, RRID: AB_10599600 IF (1:200) Antibody Anti- DNAH17 (Rabbit polyclonal) Proteintech 24488–1- AP, RRID: AB_2879568 IF (1:50) Antibody Anti- DNAI1 (Rabbit polyclonal) Proteintech 12756–1- AP, RRID: AB_10643244 IF (1:50) Antibody Anti- DNALI1 (Rabbit polyclonal) Proteintech 17601–1- AP, RRID: AB_2095372 IF (1:50), WB (1:150) Antibody Anti- TOM20 (Rabbit polyclonal) Proteintech 11802–1- AP, RRID: AB_2207530 IF (1:50) Antibody Anti- SLC25A4 (Rabbit polyclonal) Signalway 32484, RRID: AB_2941094 IF (1:100) Antibody Anti- alpha tubulin (Mouse monoclonal) Abcam ab7291, RRID: AB_2241126 IF (1:500) Wang, Shen, Yang et al. eLife 2024;13:RP96755.

Techniques: Immunofluorescence, Staining, Western Blot